Top » Catalog » SNPs » A10653

$18.00

A10653
[A10653]

A10653
HG19 Position: ChrY:15649410..15649410
Ancestral: C
Derived: G
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10653_F CAGTTCAGTCACATTGTGAAAGC
Reverse Primer: A10653_R GCATTCCAAACTCTGGATGTTAC
Reviews

Customers who bought this product also purchased
A10654
A10654
A10652
A10652
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies