Top » Catalog » SNPs » A10656

$18.00

A10656
[A10656]

A10656
HG19 Position: ChrY:6767150..6767150
Ancestral: T
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104, parallel to DF105
Forward Primer: A10656_F ATTGAGGGGTCCAATTCCTC
Reverse Primer: A10656_R CATGGTATTGGATTTGGCAAC
Reviews

Customers who bought this product also purchased
A10668
A10668
A10666
A10666
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies