Top » Catalog » SNPs » A10657

$18.00

A10657
[A10657]

A10657
HG19 Position: ChrY:7127504..7127504
Ancestral: ins
Derived: del
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10657_F CCTGGGTGACAGAACCAATC
Reverse Primer: A10657_R TAATTCCCACCCTGTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1147
1 x A10756
1 x A11684
1 x A10528
$72.00
Haplogroup Info
Other products
Currencies