Top » Catalog » SNPs » A10660

$18.00

A10660
[A10660]

A10660
HG19 Position: ChrY:11069541..11069541
Ancestral: G
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10660_F GCTGTGATGCCACCCTATTC
Reverse Primer: A10660_R GACCACATTCTGCCAGCC
Reviews

Customers who bought this product also purchased
A10664
A10664
A10663
A10663
A10661
A10661
A10671
A10671
A10669
A10669
A10665
A10665
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1071
1 x A1063
1 x A11440
1 x A10221
1 x A10140
1 x A10270
1 x A10180
1 x A1157
$144.00
Haplogroup Info
Other products
Currencies