Top » Catalog » SNPs » A10663

$17.50

A10663
[A10663]

A10663
HG19 Position: ChrY:16417180..16417180
Ancestral: T
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10663_F GTTTTCCAGGTTAATTCACTCTTCTG
Reverse Primer: A10663_R GCCAGGCTTCATACCAAGC
Reviews

Customers who bought this product also purchased
A10669
A10669
A10665
A10665
A10664
A10664
A10661
A10661
A10660
A10660
A10671
A10671
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies