Top » Catalog » SNPs » A10664

$18.00

A10664
[A10664]

A10664
hg38 Position: ChrY:14902972..14902972
Ancestral: C
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10664_F GTTCAAATCCCAATCTTGGC
Reverse Primer: A10664_R CGAATTCTCAGAATGGTCCC
Reviews

Customers who bought this product also purchased
A10660
A10660
A10671
A10671
A10669
A10669
A10665
A10665
A10663
A10663
A10661
A10661
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies