Top » Catalog » SNPs » A10667

$18.00

A10667
[A10667]

A10667
hg38 Position: ChrY:15734763..15734763
Ancestral: T
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10667_F GCACAAGACTGGGTTTCATTC
Reverse Primer: A10667_R TGGGGCCAGAGGTAACATAC
Reviews

Customers who bought this product also purchased
A10662
A10662
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies