Top » Catalog » SNPs » A10668

$17.50

A10668
[A10668]

A10668
HG19 Position: ChrY:18824766..18824766
Ancestral: G
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Dowstream of M222 > DF104
Forward Primer: A10668_F CTGGCCTCTGACAAAGTGG
Reverse Primer: A10668_R CACTGGTGCTACTGGTCTGTG
Reviews

Customers who bought this product also purchased
A10666
A10666
A10656
A10656
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies