Top » Catalog » SNPs » A10678

$18.00

A10678
[A10678]

A10678
HG19 Position: ChrY:7874210..7874210
Ancestral: A
Derived: G
Reference: Geoff Melloy (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10678_F GTTAGTGCTGTAAAGTCCTGTGAGC
Reverse Primer: A10678_R GGCTCAGCAACCTGAAAATG
Reviews

Customers who bought this product also purchased
A10679
A10679
A10677
A10677
A10681
A10681
A10682
A10682
A10680
A10680
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies