Top » Catalog » SNPs » A10683

$18.00

A10683
[A10683]

A10683
HG19 Position: ChrY:19449777..19449777
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10683_F TGGGACCTACCTTCAACAGG
Reverse Primer: A10683_R GTCCTTCCTAGGTGGGATCG
Reviews

Customers who bought this product also purchased
A7257
A7257
A10684
A10684
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10841
1 x A11530
1 x A11029
1 x A10990
1 x A11375
1 x A11144
1 x A11309
1 x A11116
1 x A11525
1 x A10586
1 x A11495
$198.00
Haplogroup Info
Other products
Currencies