Top » Catalog » SNPs » A10684

$18.00

A10684
[A10684]

A10684
hg38 Position: ChrY:12824534..12824534
Ancestral: T
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10684_F GTTTTGCAAGATGCTATTGCTG
Reverse Primer: A10684_R GCCACCTACCTTCCCTTACC
Reviews

Customers who bought this product also purchased
A7257
A7257
A10683
A10683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies