Top » Catalog » SNPs » A10727

$18.00

A10727
[A10727]

A10727
HG19 Position: ChrY:14243038..14243038
Ancestral: T
Derived: A
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of Z16259
Forward Primer: A10727v2_F GCCAGCATTGTACTGATACCAAC
Reverse Primer: A10727v2_R GGTTTCTCATAAACAGCCCTTATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10866
1 x A11329
$36.00
Haplogroup Info
Other products
Currencies