Top » Catalog » SNPs » A10728

$17.50

A10728
[A10728]

A10728
HG19 Position: ChrY:2717889..2717889
Ancestral: G
Derived: A
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10728_F GAGGGCCCTACAGTCTTTGG
Reverse Primer: A10728_R AGCTGACTGACCAGGTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies