Top » Catalog » SNPs » A10728

$18.00

A10728
[A10728]

A10728
HG19 Position: ChrY:2849848..2849848
Ancestral: G
Derived: A
Reference: Denis Savard (2016)
ISOGG Haplogroup: E1b1b1b2a1a4d2~ (not listed)
Comments: Downstream of Y6923
Forward Primer: A10728_F GAGGGCCCTACAGTCTTTGG
Reverse Primer: A10728_R AGCTGACTGACCAGGTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10133
$18.00
Haplogroup Info
Other products
Currencies