Top » Catalog » SNPs » A10729

$18.00

A10729
[A10729]

A10729
HG19 Position: ChrY:7987926..7987926
Ancestral: C
Derived: A
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10729_F CACACTGAAATTGTTTAGTTTTGCAG
Reverse Primer: A10729_R CAAGTTAGGGGATGGTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10441
1 x A11428
1 x A11109
1 x A11611
$72.00
Haplogroup Info
Other products
Currencies