Top » Catalog » SNPs » A10732

$17.50

A10732
[A10732]

A10732
HG19 Position: ChrY:15344920..15344920
Ancestral: G
Derived: C
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10732_F GGCAACACATAGATCTCCATTTC
Reverse Primer: A10732_R AGCATTCCTTTGTGCCAAC
Reviews

Customers who bought this product also purchased
A10731
A10731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies