Top » Catalog » SNPs » A10733

$18.00

A10733
[A10733]

A10733
HG19 Position: ChrY:15428196..15428196
Ancestral: A
Derived: C
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10733_F AGGTGCCTCTGACCTTTCAC
Reverse Primer: A10733_R GCCAAAGCAAACCACAGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies