Top » Catalog » SNPs » A10734

$18.00

A10734
[A10734]

A10734
HG19 Position: ChrY:14449027..14449027
Ancestral: G
Derived: A
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10734_F CACATAAACTGCTAAGGAAAGAAATC
Reverse Primer: A10734_R GTCTTTCGATTTATGAAGTATAGCTACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10869
1 x A10748
1 x A10875
1 x A10586
1 x A10174
1 x A10874
1 x A10525
1 x A11124
1 x A11112
1 x A10563
$180.00
Haplogroup Info
Other products
Currencies