Top » Catalog » SNPs » A10736

$18.00

A10736
[A10736]

A10736
HG19 Position: ChrY:22696852..22696852
Ancestral: A
Derived: G
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y6923
Forward Primer: A10736_F AGAGATGAAATGAAAAGGAGAAGC
Reverse Primer: A10736_R CTTGAATCCAAGAGGTGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies