Top » Catalog » SNPs » A10738

$18.00

A10738
[A10738]

A10738
hg38 Position: ChrY:15299123..15299123
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10738_F GCAGCAGCTCTGACATCTTG
Reverse Primer: A10738_R ATACGCACATTCTTTCATTTGG
Reviews

Customers who bought this product also purchased
A6091
A6091
S744
S744
FGC32580
FGC32580
A9880
A9880
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
FGC32575
FGC32575
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies