Top » Catalog » SNPs » A10738

$17.50

A10738
[A10738]

A10738
HG19 Position: ChrY:17411003..17411003
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10738_F GCAGCAGCTCTGACATCTTG
Reverse Primer: A10738_R ATACGCACATTCTTTCATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies