Top » Catalog » SNPs » A10739

$17.50

A10739
[A10739]

A10739
HG19 Position: ChrY:18996057..18996057
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10739_F GTGTTTCTGCCAGCTGTGG
Reverse Primer: A10739_R GCTTACAGATGCCCACCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies