Top » Catalog » SNPs » A10740

$18.00

A10740
[A10740]

A10740
HG19 Position: ChrY:19308552..19308552
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10740_F TCCTGTAACTGGGGACCTTG
Reverse Primer: A10740_R TAAATGAGCGCCAAAAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10286
1 x A11446
1 x A10673
1 x A10164
1 x A11155
1 x A11018
1 x A10575
$126.00
Haplogroup Info
Other products
Currencies