Top » Catalog » SNPs » A10741

$18.00

A10741
[A10741]

A10741
HG19 Position: ChrY:8090729..8090729
Ancestral: A
Derived: C
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream of Y5280
Forward Primer: A10741_F CCTATGGTAAAGAATTTAAGCCAGAAG
Reverse Primer: A10741_R CATCCCATATTTACAAAGCGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10569
$18.00
Haplogroup Info
Other products
Currencies