Top » Catalog » SNPs » Y170456

$19.00

Y170456
[Y170456]

Y170456
hg38 Position: ChrY:15528234..15528234
Ancestral: C
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: J2b
Comments: Below M12 > M205 > Y128176
Forward Primer: Y170456_F CTATCCATGAGCAAGGAATGC
Reverse Primer: Y170456_R ATCAATGCAAAAATCCTCAGC
Reviews (1)

Customers who bought this product also purchased
Y128176
Y128176
M205
M205
WGS+
WGS+
Y130241
Y130241
FGC67072
FGC67072
Y170475
Y170475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y170456
$19.00
Haplogroup Info
Other products
Currencies