Top » Catalog » SNPs » ZS4754

$19.00

ZS4754
[ZS4754]

ZS4754
hg38 Position: ChrY:8932062..8932062
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4316; Found in Big Y sample M9483
Forward Primer: ZS4754_F CCCTCCACATCCAGATATGTG
Reverse Primer: ZS4754_R CAGTGGGTGCATCAGCTTAGT
Reviews

Customers who bought this product also purchased
FGC4314
FGC4314
J1-FGC5 Panel
J1-FGC5 Panel
M96
M96
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies