Top » Catalog » SNPs » FT49595

$18.00

FT49595
[FT49595]

FT49595
hg38 Position: ChrY:7147265..7147265
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4415
Forward Primer: FT49595_F CTGAGTCGTTGAAACTACAAGTGG
Reverse Primer: FT49595_R ATCCCATCTCTACTAAAAACATGAAAG
Reviews

Customers who bought this product also purchased
FGC4415
FGC4415
DC796
DC796
FGC11
FGC11
FT49600
FT49600
FGC5
FGC5
ZS9200
ZS9200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies