Top » Catalog » SNPs » FGC17938

$19.00

FGC17938
[FGC17938]

FGC17938
hg38 Position: ChrY:13094669..13094669
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC17938_F GGAAGTCAGTGTGACTTGGTTTG
Reverse Primer: FGC17938_R CCTTTCAATAGCACCAAGCTG
Reviews

Customers who bought this product also purchased
FGC20611
FGC20611
FGC43088
FGC43088
Y125244
Y125244
FT63450
FT63450
FGC42321
FGC42321
FGC52058
FGC52058
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies