Top » Catalog » SNPs » FGC17938

$18.00

FGC17938
[FGC17938]

FGC17938
hg38 Position: ChrY:13094669..13094669
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC17938_F GGAAGTCAGTGTGACTTGGTTTG
Reverse Primer: FGC17938_R CCTTTCAATAGCACCAAGCTG
Reviews

Customers who bought this product also purchased
FGC17897
FGC17897
FGC17898
FGC17898
FGC19454
FGC19454
M343
M343
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies