Top » Catalog » SNPs » FGC17983

$18.00

FGC17983
[FGC17983]

FGC17983
hg38 Position: ChrY:20365893..20365893
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1050 > S1047
Forward Primer: FGC17983_F TGGAGCTATAAATTGAAAAATGTTG
Reverse Primer: FGC17983_R CTGAAGGCAGGGTCTTGTTC
Reviews

Customers who bought this product also purchased
Z16500
Z16500
S16264
S16264
Z253
Z253
Z255
Z255
S1026
S1026
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A479
$18.00
Haplogroup Info
Other products
Currencies