Top » Catalog » SNPs » FGC19425

$18.00

FGC19425
[FGC19425]

FGC19425
hg38 Position: ChrY:10109303..10109303
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19425_F GGCATCCCTATCTTCTGTCG
Reverse Primer: FGC19425_R GCCAGCATCATCCTGAGAG
Reviews

Customers who bought this product also purchased
FGC19428
FGC19428
FGC23335
FGC23335
FGC32883
FGC32883
FGC19435
FGC19435
FGC31784
FGC31784
FGC33211
FGC33211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies