Top » Catalog » SNPs » S1046

$18.00

S1046
[S1046]

S1046
hg38 Position: ChrY:12845209..12845209
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S1046v2_F CTGTCTATAACGTAGAATGGCTTACG
Reverse Primer: S1046v2_R CAAATGATTTTAGATGATTCCAAATTC
Reviews

Customers who bought this product also purchased
S1057
S1057
FGC17986
FGC17986
R1b-S1051 - S1050A4 type
R1b-S1051 - S1050A4 type
FGC17993
FGC17993
S1048
S1048
FGC17983
FGC17983
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies