Top » Catalog » SNPs » A10760

$18.00

A10760
[A10760]

A10760
HG19 Position: ChrY:8916341..8916341
Ancestral: A
Derived: G
Reference: Thomas Bean (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > FGC30918
Forward Primer: A10760_F GGTGGGGAAAGTTGATCTGG
Reverse Primer: A10760_R AGTTTTGTAGTCTTTCTGAAGAGGATG
Reviews

Customers who bought this product also purchased
Y15641
Y15641
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11293
1 x A1117
1 x A117
1 x A11691
1 x A10854
$90.00
Haplogroup Info
Other products
Currencies