Top » Catalog » SNPs » A10761

$18.00

A10761
[A10761]

A10761
HG19 Position: ChrY:15595666..15595666
Ancestral: T
Derived: C
Reference: Thomas Bean (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF27 > A431 > FGC30918
Forward Primer: A10761_F AAAACCTGATGTTTATGAATCATTTATTATG
Reverse Primer: A10761_R CCTAAGATTTATGAAATGTGTTCCATAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies