Top » Catalog » SNPs » A10762

$18.00

A10762
[A10762]

A10762
HG19 Position: ChrY:21046414..21046414
Ancestral: C
Derived: G
Reference: Thomas Bean (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF27 > A431 > FGC30918
Forward Primer: A10762_F CCCAAGCCAGAGTGCAGTAG
Reverse Primer: A10762_R AGGCCACTGGCATTAGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11613
1 x A11652
1 x A11006
$54.00
Haplogroup Info
Other products
Currencies