Top » Catalog » SNPs » A10763

$18.00

A10763
[A10763]

A10763
HG19 Position: ChrY:21389709..21389709
Ancestral: A
Derived: T
Reference: Thomas Bean (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF27 > A431 > FGC30918
Forward Primer: A10763_F CTGAGACTGTGTCCACTTACATTCTC
Reverse Primer: A10763_R TCTGGCCCTACCTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10994
$18.00
Haplogroup Info
Other products
Currencies