Top » Catalog » SNPs » A10742

$18.00

A10742
[A10742]

A10742
HG19 Position: ChrY:7769348..7769348
Ancestral: T
Derived: A
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP96
Forward Primer: A10742_F GGATGCTACAAAGCCTAGAAGAG
Reverse Primer: A10742_R TGTGTTCACATAACATCTGTTCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies