Top » Catalog » SNPs » A10745

$18.00

A10745
[A10745]

A10745
HG19 Position: ChrY:8272729..8272729
Ancestral: T
Derived: G
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP33
Forward Primer: A10745_F GTGGTCCACCCACCCTATC
Reverse Primer: A10745_R TGCAAATCTATTGCTTTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies