Top » Catalog » SNPs » A10746

$18.00

A10746
[A10746]

A10746
HG19 Position: ChrY:8203345..8203345
Ancestral: T
Derived: C
Reference: Debra Dunbar Nowell (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S5750 > ZP33
Forward Primer: A10746_F AGCACAACTGAAATTGTGACATG
Reverse Primer: A10746_R CAGCAATATTTCACAATCTCTCCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies