Top » Catalog » SNPs » A10701

$18.00

A10701
[A10701]

A10701
HG19 Position: ChrY:15172384..15172384
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1a (not listed)
Comments: Downstream I1-Z140 Z141+ [13] A1603+ Branch
Forward Primer: A10701_F CTTAGATCCAATTCTCATCTCCG
Reverse Primer: A10701_R AGTACATCCATGTTACAGTGTTTATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies