Top » Catalog » SNPs » A10702

$18.00

A10702
[A10702]

A10702
HG19 Position: ChrY:16094567..16094567
Ancestral: C
Derived: T
Reference: William Hartley (2016)
ISOGG Haplogroup: I1a (not listed)
Comments: Downstream I1-Z140 Z141+ [13] A1603+ Branch
Forward Primer: A10702_F AGGAAACACTGTTAAATTTTAAAGCAC
Reverse Primer: A10702_R TTACTGGGGGTCTAGAGGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10865
$18.00
Haplogroup Info
Other products
Currencies