Top » Catalog » SNPs » A10616

$18.00

A10616
[A10616]

A10616
HG19 Position: ChrY:14957524..14957524
Ancestral: G
Derived: A
Reference: Iain McDonald (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream U106 > Z156 > S8350
Forward Primer: A10616_F CAGGAGCTCTTTATGAGTTAGAATCAG
Reverse Primer: A10616_R GACGTTGCAGTGAGAGGAGAC
Reviews

Customers who bought this product also purchased
A12527
A12527
A10618
A10618
A10617
A10617
A12528
A12528
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies