Top » Catalog » SNPs » A10840

$18.00

A10840
[A10840]

A10840
HG19 Position: ChrY:7231595..7231595
Ancestral: C
Derived: G
Reference: Denis Savard (2016)
ISOGG Haplogroup: E1b1b (not listed)
Comments: Below L791 > Y6923 > Y15561
Forward Primer: A10840_F GAGTACAGTGGTGCCATCTCC
Reverse Primer: A10840_R AGCAGGTCAAAACAGCCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies