Top » Catalog » SNPs » FGC21495

$18.00

FGC21495
[FGC21495]

FGC21495
hg38 Position: ChrY:7779017..7779017
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G2a2b2a1a1a2a2
Comments: Below L1264
Forward Primer: FGC21495_F TTCAGATAGTGCTAGATTTCTTCTATACAGTAC
Reverse Primer: FGC21495_R TCCAATGACCCAAAAGGATG
Reviews

Customers who bought this product also purchased
M9
M9
Z30715
Z30715
M253
M253
CTS342
CTS342
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
S9409
S9409
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies