Top » Catalog » SNPs » A10841

$18.00

A10841
[A10841]

A10841
HG19 Position: ChrY:13612192..13612192
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S691 > A6091
Forward Primer: A10841_F GAGAAGCCAGGGAAAGGAG
Reverse Primer: A10841_R GTGATGGCAGGTCTGTTGTG
Reviews

Customers who bought this product also purchased
A6091
A6091
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies