Top » Catalog » SNPs » A10842

$18.00

A10842
[A10842]

A10842
HG19 Position: ChrY:7222488..7222488
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10842_F TCATCTCAGTATCAGCAGACTCG
Reverse Primer: A10842_R GACTGGAGTGCAGATACCATCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11209
1 x A10586
1 x A1142
1 x A10988
1 x A11469
1 x A10306
1 x A10241
1 x A11472
1 x A10986
1 x A10034
$180.00
Haplogroup Info
Other products
Currencies