Top » Catalog » SNPs » A10843

$18.00

A10843
[A10843]

A10843
HG19 Position: ChrY:8452020..8452020
Ancestral: G
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S691 > A6091
Forward Primer: A10843_F TCACCAGGGCCATGCT
Reverse Primer: A10843_R CATTAACCCATTATAAAGTCTCTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies