Top » Catalog » SNPs » A10845

$18.00

A10845
[A10845]

A10845
hg38 Position: ChrY:19949996..19949996
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10845_F AAAGGTTGGTAGTTCTGTTTGGTC
Reverse Primer: A10845_R GGGAATTCACTTTGTTTTTAAAGG
Reviews

Customers who bought this product also purchased
A10846
A10846
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies