Top » Catalog » SNPs » A10848

$18.00

A10848
[A10848]

A10848
HG19 Position: ChrY:8470812..8470812
Ancestral: A
Derived: C
Reference: Charles Acree (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10848_F TGTGAGGGCACTCTCCAG
Reverse Primer: A10848_R GGGCAAAAGTACATGTCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10878
1 x A11210
1 x A10937
$54.00
Haplogroup Info
Other products
Currencies