Top » Catalog » SNPs » A10851

$18.00

A10851
[A10851]

A10851
HG19 Position: ChrY:8710439..8710439
Ancestral: G
Derived: T
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10851_F CTGAGGATGTGAAGCACCTG
Reverse Primer: A10851_R GCCCACCAGTGTTTTTCAAG
Reviews

Customers who bought this product also purchased
A10857
A10857
Wish a SNP
Wish a SNP
A10856
A10856
A10855
A10855
A10862
A10862
A10854
A10854
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies