Top » Catalog » SNPs » A10852

$18.00

A10852
[A10852]

A10852
HG19 Position: ChrY:14417684..14417684
Ancestral: T
Derived: G
Reference: Ron Dryden (2016)
ISOGG Haplogroup: R1b
Comments: Downstream S568
Forward Primer: A10852_F ACCCTGCCCTCATAGGTTTC
Reverse Primer: A10852_R ACCTCATGTTTGGCTTTTGG
Reviews

Customers who bought this product also purchased
A10861
A10861
A10853
A10853
A10860
A10860
A10851
A10851
A10857
A10857
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies